DECODR

​

How to run DECODR Count on Latch

1. Add DECODR to your Workspace
   1. Find DECODER in “All Workflows” and open the workflow
2. Enter parameters for DECODR
3. Launch the workflow
4. Results appear in Latch Data instantly

​

Parameters

​

Sample Names

• The names or labels of your samples

​

Sample Types

• These types are clonal or bulk. The sample type sets a limit on the number of sequences DECODR can find in an experimental trace.

​

Guide Sequences

• Enter each gRNA (max 2), 17-30 nucleotides. Don’t include the PAM (NGG) in the sequence)
• Example Value: AGTGCTGATCGTACTCAGAGGAC

​

Donor sequence (optional)

• A sequence of 36 to 300 nucleotides with homology arms at least 18bp long
• Example Value: AGTGCTGATCGTCAGCATGACGTATGACTACTACGTAGTGCTTGCTAGCTGATCG

​

Wild Type/Control File

• This can be input of one of two ways

1. File input: Browse to select your wild type/control file.
   1. Accepted File Types: .ab1, .fasta, .fastq., .txt
2. Text input: Enter the plain text sequence. This value must be at least 300 nucleotides

​

Experiment Files

• You can upload multiple files here to do a bulk analysis
• Accepted File Types: .ab1, .fasta, .fastq., .txt

​

Outputs

​

Raw Outputs

1. donor_alignment.txt
2. donor_insert.ab1
   1. logs.txt
   2. results.xlsx
3. single_t_insertion.ab1 a. logs.txt b. results.xlsx
4. dropout.ab1 a. logs.txt b. results.xlsx
5. high_edit.ab1 a. logs.txt b. results.xlsx